Utility functions related to sequence alignment
A variety of different functions used to deal with sequence alignments.
nedit(x) # also nmatch and nmismatch mismatchTable(x, shiftLeft=0L, shiftRight=0L, ...) mismatchSummary(x, ...) ## S4 method for signature 'AlignedXStringSet0' coverage(x, shift=0L, width=NULL, weight=1L) ## S4 method for signature 'PairwiseAlignmentsSingleSubject' coverage(x, shift=0L, width=NULL, weight=1L) compareStrings(pattern, subject) ## S4 method for signature 'PairwiseAlignmentsSingleSubject' consensusMatrix(x, as.prob=FALSE, shift=0L, width=NULL, baseOnly=FALSE, gapCode="-", endgapCode="-")
x |
A |
shiftLeft, shiftRight |
Non-positive and non-negative integers respectively that specify how many preceding and succeeding characters to and from the mismatch position to include in the mismatch substrings. |
... |
Further arguments to be passed to or from other methods. |
shift, width |
See |
weight |
An integer vector specifying how much each element in |
pattern, subject |
The strings to compare. Can be of type |
as.prob |
If |
baseOnly |
|
gapCode, endgapCode |
The codes in the appropriate |
mismatchTable
: a data.frame containing the positions and substrings
of the mismatches for the AlignedXStringSet
or
PairwiseAlignments
object.
mismatchSummary
: a list of data.frame objects containing counts and
frequencies of the mismatches for the AlignedXStringSet
or
PairwiseAlignmentsSingleSubject
object.
compareStrings
combines two equal-length strings that are assumed to be
aligned into a single character string containing that replaces mismatches
with "?"
, insertions with "+"
, and deletions with "-"
.
## Compare two globally aligned strings string1 <- "ACTTCACCAGCTCCCTGGCGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG" string2 <- "GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC" compareStrings(string1, string2) ## Create a consensus matrix nw1 <- pairwiseAlignment(AAStringSet(c("HLDNLKGTF", "HVDDMPNAL")), AAString("SMDDTEKMSMKL"), substitutionMatrix = "BLOSUM50", gapOpening = 3, gapExtension = 1) consensusMatrix(nw1) ## Examine the consensus between the bacteriophage phi X174 genomes data(phiX174Phage) phageConsmat <- consensusMatrix(phiX174Phage, baseOnly = TRUE) phageDiffs <- which(apply(phageConsmat, 2, max) < length(phiX174Phage)) phageDiffs phageConsmat[,phageDiffs]
Please choose more modern alternatives, such as Google Chrome or Mozilla Firefox.