Read DNA Sequences in a File
These functions read DNA sequences in a file, and returns a matrix or a
list of DNA sequences with the names of the taxa read in the file as
rownames or names, respectively. By default, the sequences are stored
in binary format, otherwise (if as.character = TRUE) in
lowercase.
read.dna(file, format = "interleaved", skip = 0,
nlines = 0, comment.char = "#",
as.character = FALSE, as.matrix = NULL)
read.FASTA(file, type = "DNA")
read.fastq(file, offset = -33)file |
a file name specified by either a variable of mode character,
or a double-quoted string. Can also be a connection (which
will be opened for reading if necessary, and if so
|
format |
a character string specifying the format of the DNA
sequences. Four choices are possible: |
skip |
the number of lines of the input file to skip before beginning to read data (ignored for FASTA files; see below). |
nlines |
the number of lines to be read (by default the file is read untill its end; ignored for FASTA files)). |
comment.char |
a single character, the remaining of the line after this character is ignored (ignored for FASTA files). |
as.character |
a logical controlling whether to return the
sequences as an object of class |
as.matrix |
(used if |
type |
a character string giving the type of the sequences: one of
|
offset |
the value to be added to the quality scores (the default applies to the Sanger format and should work for most recent FASTQ files). |
read.dna follows the interleaved and sequential formats defined
in PHYLIP (Felsenstein, 1993) but with the original feature than there
is no restriction on the lengths of the taxa names. For these two
formats, the first line of the file must contain the dimensions of the
data (the numbers of taxa and the numbers of nucleotides); the
sequences are considered as aligned and thus must be of the same
lengths for all taxa. For the FASTA and FASTQ formats, the conventions
defined in the references are followed; the sequences are taken as
non-aligned. For all formats, the nucleotides can be arranged in any
way with blanks and line-breaks inside (with the restriction that the
first ten nucleotides must be contiguous for the interleaved and
sequential formats, see below). The names of the sequences are read in
the file. Particularities for each format are detailed below.
Interleaved:the function starts to read the sequences after it finds one or more spaces (or tabulations). All characters before the sequences are taken as the taxa names after removing the leading and trailing spaces (so spaces in taxa names are not allowed). It is assumed that the taxa names are not repeated in the subsequent blocks of nucleotides.
Sequential:the same criterion than for the interleaved format is used to start reading the sequences and the taxa names; the sequences are then read until the number of nucleotides specified in the first line of the file is reached. This is repeated for each taxa.
Clustal:this is the format output by the Clustal programs (.aln). It is close to the interleaved format: the differences are that the dimensions of the data are not indicated in the file, and the names of the sequences are repeated in each block.
FASTA:This looks like the sequential format but the taxa names (or a description of the sequence) are on separate lines beginning with a ‘greater than’ character ‘>’ (there may be leading spaces before this character). These lines are taken as taxa names after removing the ‘>’ and the possible leading and trailing spaces. All the data in the file before the first sequence are ignored.
The FASTQ format is explained in the references.
Compressed files must be read through connections (see examples).
read.fastq can read compressed files directly (see
examples).
a matrix or a list (if format = "fasta") of DNA sequences
stored in binary format, or of mode character (if as.character =
"TRUE").
read.FASTA always returns a list of class "DNAbin" or
"AAbin".
read.fastq returns a list of class "DNAbin" with an
atrribute "QUAL" (see examples).
Emmanuel Paradis and RJ Ewing
Anonymous. FASTA format. https://en.wikipedia.org/wiki/FASTA_format
Anonymous. FASTQ format. https://en.wikipedia.org/wiki/FASTQ_format
Felsenstein, J. (1993) Phylip (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington. http://evolution.genetics.washington.edu/phylip/phylip.html
## a small extract from data(woddmouse) in sequential format:
cat("3 40",
"No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
"No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
"No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna <- read.dna("exdna.txt", format = "sequential")
str(ex.dna)
ex.dna
## the same data in interleaved format...
cat("3 40",
"No305 NTTCGAAAAA CACACCCACT",
"No304 ATTCGAAAAA CACACCCACT",
"No306 ATTCGAAAAA CACACCCACT",
" ACTAAAANTT ATCAGTCACT",
" ACTAAAAATT ATCAACCACT",
" ACTAAAAATT ATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna2 <- read.dna("exdna.txt")
## ... in clustal format...
cat("CLUSTAL (ape) multiple sequence alignment", "",
"No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
"No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
"No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
" ************************** ****** ****",
file = "exdna.txt", sep = "\n")
ex.dna3 <- read.dna("exdna.txt", format = "clustal")
## ... and in FASTA format
cat(">No305",
"NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
">No304",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
">No306",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = "exdna.fas", sep = "\n")
ex.dna4 <- read.dna("exdna.fas", format = "fasta")
## They are the same:
identical(ex.dna, ex.dna2)
identical(ex.dna, ex.dna3)
identical(ex.dna, ex.dna4)
## How to read compressed files:
## create the ZIP file:
zip("exdna.fas.zip", "exdna.fas")
## create the GZ file with a connection:
con <- gzfile("exdna.fas.gz", "wt")
cat(">No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
">No304", "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
">No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = con, sep = "\n")
close(con)
ex.dna5 <- read.dna(unz("exdna.fas.zip", "exdna.fas"), "fasta")
ex.dna6 <- read.dna(gzfile("exdna.fas.gz"), "fasta")
identical(ex.dna5, ex.dna4)
identical(ex.dna6, ex.dna4)
unlink("exdna.txt")
unlink("exdna.fas")
unlink("exdna.fas.zip")
unlink("exdna.fas.gz")
## read a FASTQ file from 1000 Genomes:
## Not run:
a <- "https://ftp.1000genomes.ebi.ac.uk/vol1/ftp/phase3/data/HG00096/sequence_read/"
b <- "SRR062641.filt.fastq.gz"
URL <- paste0(a, b)
download.file(URL, b)
## If the above command doesn't work, you may copy/paste URL in
## a Web browser instead.
X <- read.fastq(b)
X # 109,811 sequences
## get the qualities of the first sequence:
(qual1 <- attr(X, "QUAL")[[1]])
## the corresponding probabilities:
10^(-qual1/10)
## get the mean quality for each sequence:
mean.qual <- sapply(attr(X, "Q"), mean)
## can do the same for var, sd, ...
## End(Not run)Please choose more modern alternatives, such as Google Chrome or Mozilla Firefox.