Extract Regex Pattern Matches, Together with Capture Groups
These functions extract substrings in str that
match a given regex pattern. Additionally, they extract matches
to every capture group, i.e., to all the sub-patterns given
in round parentheses.
stri_match_all(str, ..., regex)
stri_match_first(str, ..., regex)
stri_match_last(str, ..., regex)
stri_match(str, ..., regex, mode = c("first", "all", "last"))
stri_match_all_regex(
str,
pattern,
omit_no_match = FALSE,
cg_missing = NA_character_,
...,
opts_regex = NULL
)
stri_match_first_regex(
str,
pattern,
cg_missing = NA_character_,
...,
opts_regex = NULL
)
stri_match_last_regex(
str,
pattern,
cg_missing = NA_character_,
...,
opts_regex = NULL
)str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex |
character vector; search patterns; for more details refer to stringi-search |
omit_no_match |
single logical value; if |
cg_missing |
single string to be used if a capture group match is unavailable |
opts_regex |
a named list with ICU Regex settings,
see |
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
If no pattern match is detected and omit_no_match=FALSE,
then NAs are included in the resulting matrix (matrices), see Examples.
Please note: ICU regex engine currently does not fully support named capture groups.
stri_match, stri_match_all, stri_match_first,
and stri_match_last are convenience functions.
They just call stri_match_*_regex and were
provided for consistency with other string searching functions' wrappers,
see, among others, stri_extract.
For stri_match_all*,
a list of character matrices is returned. Each list element
represents the results of a different search scenario.
For stri_match_first* and stri_match_last*
a character matrix is returned.
Each row corresponds to a different search result.
The first matrix column gives the whole match. The second one corresponds to the first capture group, the third – the second capture group, and so on.
Other search_extract:
about_search,
stri_extract_all_boundaries(),
stri_extract_all()
stri_match_all_regex('breakfast=eggs, lunch=pizza, dessert=icecream',
'(\\w+)=(\\w+)')
stri_match_all_regex(c('breakfast=eggs', 'lunch=pizza', 'no food here'),
'(\\w+)=(\\w+)')
stri_match_all_regex(c('breakfast=eggs;lunch=pizza',
'breakfast=bacon;lunch=spaghetti', 'no food here'),
'(\\w+)=(\\w+)')
stri_match_first_regex(c('breakfast=eggs;lunch=pizza',
'breakfast=bacon;lunch=spaghetti', 'no food here'),
'(\\w+)=(\\w+)')
stri_match_last_regex(c('breakfast=eggs;lunch=pizza',
'breakfast=bacon;lunch=spaghetti', 'no food here'),
'(\\w+)=(\\w+)')
stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$')
stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$', cg_missing='')
# Match all the pattern of the form XYX, including overlapping matches:
stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\2))')[[1]][,2]
# Compare the above to:
stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\1')Please choose more modern alternatives, such as Google Chrome or Mozilla Firefox.