Locate Occurrences of a Pattern
These functions may be used, e.g., to find the indexes (positions) where
there is a match to some pattern.
The functions stri_locate_all_* locate all the matches.
stri_locate_first_* and stri_locate_last_*
give the first or the last matches, respectively.
stri_locate_all(str, ..., regex, fixed, coll, charclass)
stri_locate_first(str, ..., regex, fixed, coll, charclass)
stri_locate_last(str, ..., regex, fixed, coll, charclass)
stri_locate(
str,
...,
regex,
fixed,
coll,
charclass,
mode = c("first", "all", "last")
)
stri_locate_all_charclass(str, pattern, merge = TRUE, omit_no_match = FALSE)
stri_locate_first_charclass(str, pattern)
stri_locate_last_charclass(str, pattern)
stri_locate_all_coll(
str,
pattern,
omit_no_match = FALSE,
...,
opts_collator = NULL
)
stri_locate_first_coll(str, pattern, ..., opts_collator = NULL)
stri_locate_last_coll(str, pattern, ..., opts_collator = NULL)
stri_locate_all_regex(
str,
pattern,
omit_no_match = FALSE,
...,
opts_regex = NULL
)
stri_locate_first_regex(str, pattern, ..., opts_regex = NULL)
stri_locate_last_regex(str, pattern, ..., opts_regex = NULL)
stri_locate_all_fixed(
str,
pattern,
omit_no_match = FALSE,
...,
opts_fixed = NULL
)
stri_locate_first_fixed(str, pattern, ..., opts_fixed = NULL)
stri_locate_last_fixed(str, pattern, ..., opts_fixed = NULL)str |
character vector; strings to search in |
... |
supplementary arguments passed to the underlying functions,
including additional settings for |
mode |
single string;
one of: |
pattern, regex, fixed, coll, charclass |
character vector; search patterns; for more details refer to stringi-search |
merge |
single logical value;
indicates whether consecutive sequences of indexes in the resulting
matrix should be merged; |
omit_no_match |
single logical value; if |
opts_collator, opts_fixed, opts_regex |
a named list used to tune up
the search engine's settings; see
|
Vectorized over str and pattern (with recycling
of the elements in the shorter vector if necessary). This allows to,
for instance, search for one pattern in each given string,
search for each pattern in one given string,
and search for the i-th pattern within the i-th string.
The matches may be extracted by calling
stri_sub or stri_sub_all.
Alternatively, you may call stri_extract directly.
stri_locate, stri_locate_all, stri_locate_first,
and stri_locate_last are convenience functions.
They just call stri_locate_*_*, depending on the arguments used.
For stri_locate_all_*,
a list of integer matrices is returned. Each list element
represents the results of a separate search scenario.
The first column gives the start positions
of the matches, and the second column gives the end positions.
Moreover, you may get two NAs in one row
for no match (if omit_no_match is FALSE)
or NA arguments.
stri_locate_first_* and stri_locate_last_*
return an integer matrix with
two columns, giving the start and end positions of the first
or the last matches, respectively, and two NAs if and
only if they are not found.
For stri_locate_*_regex, if the match is of zero length,
end will be one character less than start.
Note that stri_locate_last_regex searches from start to end,
but skips overlapping matches, see the example below.
Other search_locate:
about_search,
stri_locate_all_boundaries()
Other indexing:
stri_locate_all_boundaries(),
stri_sub_all(),
stri_sub()
stri_locate_all('XaaaaX',
regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_all('Bartolini', fixed='i')
stri_locate_all('a b c', charclass='\\p{Zs}') # all white spaces
stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}')
stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE)
stri_locate_first_charclass('AaBbCc', '\\p{Ll}')
stri_locate_last_charclass('AaBbCc', '\\p{Ll}')
stri_locate_all_coll(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale='sk_SK')
stri_locate_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale='sk_SK')
pat <- stri_paste('\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ',
'\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ')
stri_locate_last_coll('\ufdfa\ufdfa\ufdfaXYZ', pat, strength = 1)
stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a', case_insensitive=TRUE, overlap=TRUE)
stri_locate_first_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')
stri_locate_last_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')
#first row is 1-2 like in locate_first
stri_locate_all_fixed('bbbbb', 'bb')
stri_locate_first_fixed('bbbbb', 'bb')
# but last row is 3-4, unlike in locate_last,
# keep this in mind [overlapping pattern match OK]!
stri_locate_last_fixed('bbbbb', 'bb')
stri_locate_all_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_first_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_last_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
# Use regex positive-lookahead to locate overlapping pattern matches:
stri_locate_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=AGA)')
# note that start > end here (match of 0 length)
# Searching for the last occurrence:
stri_locate_last_fixed("agaga", "aga")
stri_locate_last_coll("agaga", "aga")
# note the difference - regex searches left to right, with no overlaps:
stri_locate_last_regex("agaga", "aga")Please choose more modern alternatives, such as Google Chrome or Mozilla Firefox.